Adresses des entreprises Marocaines

1  2  3  4  5  7  A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z  


Entreprise Axo art média s.a.r.l

Adresse : 219, bd Mohamed Zerktouni , rés. ElBar­dai appt.1.


Ville : Casablanca


Téléphone : 0522 39 80 35


Fax : 0522 39 79 78


Code postal : 20100


Activité :


Déscription :


La fiche de l'entreprise Axo art média s.a.r.l a eu 1494 visites.




Axo art média s.a.r.l est une entreprise marocaine domicilié dans la ville de Casablanca

Entreprises de la męme ville


Bandatex s.a.r.I

53, rue Oukhouane - ex Capit. Portalis


F.e.a. Maroc s.a.

7, rue Bouchaib Farad -ex Caillaux


Texcom s.a.

101, rue des Mimosas (Beauséjour


City service international

5, rue Abou Taour -ex sgt René Montanon


C.m.h. Horlogerie

3, rue Mohamed Belloul -ex Pégoud


Dimex

73, bd Moulay Slimane


Dewhirst Childrenswear Morocco

z. ind. BenM'Sik Sidi Othman , lot n°149.


Durcoplast

265, bd Moulay Ismail (Roches Noires


Axo art média s.a.r.l - résultat depuis le web

-La société CAR&BOAT MEDIA, ... L'utilisation du site annoncesdubateau.com ne crée aucune obligation de contacter avec les ... (art. 1641 et suivants.) ...

-exon i 52579495 ctggggaccatggagacccagagggccagcctctccctggggcgctggtcgctgtggctg m··e··t··q··r··a··s··l··s··l··g··r··w··s··l··w··l·

-S.a.r.l. Corporate capital: ... Art Néon. Casablanca. Publicity panels. ... Axo Top Média. Casablanca. Publicity panels. Shem's de Signalisation.

-Pôle Média Culture Edmond Gerrer Musée ... The André Malraux Contemporary Art Gallery usually hosts 5 exhibitions per year including a presentation of work by

-Art Fleurs Et Jardins ... J'ai trouvé 1 autre société est qui est à la même adresse que S.a.r.l ... d'offrir des fonctionnalités relatives aux médias sociaux ...

-Le site du journal L'Union de Reims - lunion.fr

-S.a.r.l. Corporate capital: ... Art Néon. Casablanca. Publicity panels. France-Néon. ... Axo Top Média. Casablanca. Publicity panels. Orimetal. Casablanca.

-S.a.r.l. Corporate capital: ... Vision Art. Casablanca. Publicity panels. Pack Design. Casablanca. Publicity panels. Axo Top Média. Casablanca. Publicity panels.

-You searched for: axo apparel! ... Let?s get started! Close. Beginning of a dialog window, ... Art & Photography Books

-Au Québec, les médias [1] diffusent l'information, la publicité et la culture à l'aide d'une grande variété de moyens de communication comme l'affichage, la ...

Publicité